The Great Hoax... no, not big foot

One of the great hoaxes in human history ( besides big foot) is the Piltdown Hoax.  England 1912 Charles Dawson discovered what would be identified as the first remains of early humans in England. This was a fascinating find for the scientific community as it would shed light on evolution and how human like the skull was.  Fast forward to 1953 and Dawson discovery crumbled as it was proved to be a hoax, Time Magazine  published the evidence gathered by 3 scientists that showed the jaw of the skull and some teeth were from monkeys, presumably it  showed to be that of an orangutan and chimpanzee, under close examination it was noted that the teeth had been filed down to a shape more suitable for that of a human diet, and the rest of the skull was a human skull from the medieval ages. The shock came when scientist recognized that it was man made discovery by fellow scientists .

After WWII the scientific community began to use fluorine content to date fossils, this leads to the Piltdown man to be examined and the result was contradicting to that of its claims, first it dated at about 100,00 years, baffled by this scientist did a larger scale and the result were more eerie, the remains were less than 100 years old. Their final analysis showed that the staining was superficial and it had been cut after being fossilized, a microscope showed the teeth had been filed down. Although it was a setback for science it also showed the positive effects of the scientific process. It was using scientific methods that led to the discovery of the hoax. 

Removing the human element from science would not make any sense, due to our impressive cognitive abilities, are curious and we like to understand our surroundings. It is what makes science so exciting. The human element of discovery and understanding makes science what it is and I would not remove that element from science. Even evolution is a process of trial and error; Science can be successful the same way.

There is a reason why the scientific method was invented, regarding science I have learned to only believe what can be proven time after time by different people and it has a vast amount of prove to back it up, just as in life we see all this post in social media, and even in the News that try to exaggerate or make things seem differently than what they are and its best to really examine what we are being presented with and be logical.

Homology and Analogy at its finest

a- leg of a frog
b- leg of a lizard

Lizards and frogs both being reptiles and having a similar bone structure in their legs are a great example for homologous traits. Both lizards and frogs move differently, for example, a frog jumps to move around while a lizard crawls quickly. This is due to the traits changing through evolution, having a common ancestor and passing this trait around is what gives this two reptiles the similar bone structure, however, their different habitats allowed for this significant change to occur as part of natural selection. although still unknown as to when this two amphibians separated into two different species

It is commonly known that lizards and frogs are descendants from an ancestor known as Gerobatrachus Hottoni.

Dolphins and sharks can be placed as having analogous traits,  dolphins are warm- blooded and sharks are cold blooded but they still share a torpedo shaped body, dorsal fins, and side fins. One could even say they are cousins, This is likely due to adaptation to new environment from the dolphin perspective because they do not share a common ancestor, Sharks have been around dating back to 400 million years ago while dolphins date only from 20 – 25 million years ago and are descendant from a land dwelling mammal.

messages through DNA strands...

GTGCTACCAACCGAACGGCAGTGCAAGCCCCAAATTGTCTATCGGC

Valentine Baby Inspires the Theory of Evolution

Thomas Malthus arguably born on valentine's day ( February 14, 1766) was not a man of science but an economist who introduced population growth and decline to Darwins observations in the Galapagos. He had the idea that areas with vast resources would grow in population, and once the resources decreased so would the population. It was this idea transformed on the Essay the Principle of Population that helped Darwin shape one of his most notorious studied theories,  Natural Selection "survival of the fittest".

Malthus directly affected Darwins view on the fact that resources are limited and those with better resources would be more successful, his findings on population growth mirrored Darwins finding as a tell sing that he was on the right track. Darwin as a few others praised and gave  much credit to Malthus for helping develop the theory of Natural Selection. 

In my opinion, although Darwin has accredited Malthus for being an influence, the overwhelming evidence of Natural Selection Darwin found on his expeditions would ultimately lead him to the same conclusion. 

Darwin kept most of his findings to himself with the exception of his brother, he knew that going public meant challenging the church more specifically their believe on how the earth came to be as pictured in Genesis the first book of the bible. It was not until he was completely satisfied with his research which took 23 years that he felt comfortable with making his finding public. 

Thomas Malthus Source